angiotensin IV is one of those subjects where the details matter more than the headlines. This page pulls together the background, the mechanisms, and the practical points readers ask about most.
Updated 2025-11-01. Numbers and descriptions here follow the published literature rather than marketing material.
Development of dihexa has been linked to academic research on synaptogenesis, the formation of new synapses. Preclinical studies in rodents have examined its effects on learning and memory tasks. These studies are often cited in discussions about cognitive enhancement, but they do not establish safety or efficacy in humans. The compound's patent and commercial history is limited, and it is not widely available through pharmaceutical channels. Most information comes from animal models and in vitro experiments. Researchers continue to explore its basic biology rather than clinical applications.
Dihexa is not approved for human use in the United States or the European Union. It is commonly sold as a research chemical, a category that may not require the same regulatory review as medicines. Buyers should note that product labels may lack independent verification of identity or purity. The legal status can vary by country, and importation may be restricted. Reliable information about sourcing and quality is often scarce. Scientific publications typically use synthesized material from laboratories rather than commercial consumer products.
Dihexa is a synthetic peptide studied in laboratory research. It is often described as an angiotensin IV analog or a hepatocyte growth factor mimetic. The compound emerged from investigations into angiotensin IV and its effects on neural pathways. It is not an approved medication, and controlled human trials are lacking. In literature and online forums, it is discussed mainly as a research chemical. Its chemical name appears as N-hexanoic-Tyr-Ile-(6-aminohexanoic amide) in some sources.
Dihexa is a synthetic peptide with the chemical name N-hexanoic-Tyr-Ile-(6)-aminohexanoic amide, and it is structurally related to angiotensin IV, a naturally occurring peptide fragment. Researchers developed it as a modified analog intended to alter stability and activity relative to the parent peptide. Its short sequence and fatty acid chain distinguish it from many endogenous peptides, and published studies often describe it under the abbreviation dihexa. The compound is classified as a laboratory compound rather than an approved therapeutic in most jurisdictions.
Early laboratory work focused on its effects on synaptic connectivity and neuronal signaling. In cell and animal models, dihexa has been reported to promote the formation of new synapses, a process called synaptogenesis. These findings have generated interest in cognitive research, but the evidence base remains mostly preclinical. Human clinical trials with clear safety and efficacy endpoints are limited or absent in the public literature. Whether these effects translate to humans is an open question.
| Property | Value | Notes |
|---|---|---|
| CAS Registry Number | 1401708-83-5 | Identifier used in chemical databases. |
| Common synonyms | P21; N-hexanoic-Tyr-Ile-(6-aminohexanoic amide) | Names vary by supplier and publication. |
| Physical form | White to off-white powder | Lyophilized solid typical of peptides. |
| Solubility | Soluble in DMSO; limited in water | Aqueous preparation may need a co-solvent. |
| Storage | -20 °C, desiccated, protected from light | Reduce freeze-thaw cycles to maintain stability. |
The leading hypothesis for dihexa centers on hepatocyte growth factor (HGF) and its receptor, c-Met. In cell-based assays, dihexa has been reported to potentiate HGF-dependent signaling. That pathway influences cell growth, survival, and motility. Because c-Met signaling is widespread, the proposed mechanism is broad rather than specific to neurons. The exact binding site and stoichiometry remain areas of active investigation, and independent replication is limited. This uncertainty limits firm conclusions about how the compound acts in living organisms.
Animal studies have examined dihexa in models of cognitive impairment, synaptic plasticity, and memory. Some reports describe improved performance on maze or avoidance tasks after administration. These findings are preclinical and often involve small samples, varied routes, and differing formulations. Results in rodents do not establish effects in humans. The absence of published randomized controlled trials in people is a major gap in the evidence base. Observational reports and user accounts do not substitute for controlled clinical data.
Discussion in the literature often separates direct receptor activation from downstream growth-factor modulation. Dihexa is not simply an angiotensin receptor blocker or a classic nootropic drug. Its proposed action may depend on endogenous HGF levels, which vary by tissue and physiological state. Questions remain about brain penetration, metabolic stability, and active metabolites. Reviews note that mechanistic claims should be treated as hypotheses until supported by independent studies. That distinction is important when interpreting promotional claims or early laboratory findings.
In laboratory settings, dihexa is typically handled as a lyophilized peptide powder. Appropriate personal protective equipment and a ventilated workspace are standard practices for weighing and transferring research chemicals. Because the compound lacks regulatory approval for clinical use, it should not be given to people. Institutional safety rules and local regulations govern its acquisition, storage, and disposal. Suppliers often provide a certificate of analysis that lists purity, identity, and batch-specific handling notes.
Dissolution depends on the peptide’s salt form, purity, and the chosen solvent. Dimethyl sulfoxide is commonly used to prepare concentrated stock solutions, while aqueous buffers may show limited solubility. Sonication or gentle warming can sometimes aid dissolution, but excessive heat may promote degradation. Once in solution, the material is generally kept cold and protected from light. Researchers should verify solubility for each lot rather than assuming uniform behavior across suppliers.
Chemically, dihexa is a short peptide-like molecule with nonstandard components. Its structure includes tyrosine and isoleucine residues linked to a hexanoic acid group and an aminohexanoic amide segment. This design distinguishes it from endogenous angiotensin IV, though the two are discussed together because of shared origins. Published summaries classify it as a small synthetic peptide with lipophilic features that may influence how it crosses biological barriers in experimental systems. Exact conformational details depend on the specific salt or free base form.
Regulatory treatment varies by country. Dihexa does not appear in major pharmacopeias as a licensed therapeutic substance. Suppliers may use labels such as research use only or not for human consumption. Such labels reflect legal and quality-control boundaries rather than evidence of clinical benefit. Importation, possession, and sale can be restricted depending on local laws, and enforcement focuses on claims, distribution channels, and product categories. These rules can change, and they differ from rules for approved medicines.
Human safety data are sparse. No widely accepted dosing regimen, long-term safety profile, or clinical efficacy endpoint has been established. Published animal results can suggest directions for further study, but species differences and study design limit direct translation. Open questions include bioavailability, blood-brain barrier penetration, metabolism, and whether observed effects arise from a single target or multiple pathways. Replication across independent laboratories remains an important benchmark for evaluating the strength of preclinical claims.
Most published reports on dihexa come from cell cultures and animal models. Studies have examined markers of synapse formation, dendritic spine density, and performance on learning tasks in rodents. Proposed mechanisms center on hepatocyte growth factor and its c-Met receptor, with additional attention to angiotensin IV-related pathways. These findings are experimental and have not been confirmed as clinical benefits in humans. The literature often uses different tasks and endpoints, which complicates direct comparison across studies.
Regulatory status differs by country, but dihexa is generally not approved as a therapeutic product. It is often sold as a research chemical, which means purity, labeling, and handling fall outside pharmaceutical drug standards. Some jurisdictions restrict the sale of peptides intended for human consumption. Researchers and suppliers may therefore face different legal requirements depending on location. Import rules and customs enforcement can also affect how such compounds move across borders.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
The team consisted of officials from the Department of Foreign Affairs and members of the Defence Forces, including Army Ranger Wing personnel. 24 April – Fifty Irish citizens were evacuated on French and Spanish aircraft from Khartoum in Sudan to safety in Djibouti. It was announced that Ireland had purchased two Airbus C295 maritime patrol aircraft capable of future airlift missions, while Airbus will supply an additional military transport aircraft to Ireland in 2025. 25 April Seventy-two Irish citizens and their families were rescued with the help of France and Spain from violence in Sudan to safety in Djibouti and Jordan. An Irish metal and polymer lunar soil experiment produced by the Dublin City University School of Chemical Sciences was lost when the Japanese Hakuto-R Mission 1 Moon landing spacecraft carrying the Rashid Lunar Rover built by the United Arab Emirates stopped communicating during the final moments of an automated Moon landing attempt in the Atlas Crater. 26 April – Sixteen more Irish citizens and their family members were rescued since the day before via Djibouti, Jordan, and Cyprus, from the fighting which broke out on 15 April in Sudan. More than 100 Irish people remained in the country. 30 April – After evacuating 209 Irish people and their families in the past week, the Emergency Civil Assistance Team was withdrawn from Sudan.
== Theory == The use of micelles in high performance liquid chromatography was first introduced by Armstrong and Henry in 1980. The technique is used mainly to enhance retention and selectivity of various solutes that would otherwise be inseparable or poorly resolved. Micellar liquid chromatography (MLC) has been used in a variety of applications including separation of mixtures of charged and neutral solutes, direct injection of serum and other physiological fluids, analysis of pharmaceutical compounds, separation of enantiomers, analysis of inorganic organometallics, and a host of others. One of the main drawbacks of the technique is the reduced efficiency that is caused by the micelles. Despite the sometimes poor efficiency, MLC is a better choice than ion-exchange LC or ion-pairing LC for separation of charged molecules and mixtures of charged and neutral species. Some of the aspects which will be discussed are the theoretical aspects of MLC, the use of models in predicting retentive characteristics of MLC, the effect of micelles on efficiency and selectivity, and general applications of MLC. Reverse phase high-performance liquid chromatography (RP-HPLC) involves a non-polar stationary phase, often a hydrocarbon chain, and a polar mobile or liquid phase. The mobile phase generally consists of an aqueous portion with an organic addition, such as methanol or acetonitrile. When a solution of analytes is injected into the system, the components begin to partition out of the mobile phase and interact with the stationary phase.
Sources: en.wikipedia.org
Cefuroxime axetil, sold under the brand name Ceftin among others, is a second generation oral cephalosporin antibiotic. It is an acetoxyethyl ester prodrug of cefuroxime which is effective orally. The activity depends on in vivo hydrolysis and release of cefuroxime tablets. It was patented in 1976 and approved for medical use in 1987.
=== Build === Though Neanderthals are often imagined as short and stocky, they were on average the same height as pre-industrial Europeans, or even slightly taller. The body mass index of the average European Neanderthal was comparable to 20th century Canadians and Americans. Neanderthal body size varied by location; West Asian Neanderthals were taller and more slightly built than European Neanderthals. In a sample of 45 Neanderthal long bones from 14 men and 7 women, the average height was 164 to 168 cm (5 ft 5 in to 5 ft 6 in) for males and 152 to 156 cm (5 ft 0 in to 5 ft 1 in) for females. The fossil record shows that adult Neanderthals varied from about 147.5 to 177 cm (4 ft 10 in to 5 ft 10 in) in height. The average male body mass index was 26.9–28.3. Neanderthal pelvic bones were extremely wide; with Neanderthal male hips being approximately 31% wider than those of modern humans males. As in all archaic species, there is no evidence of sexual dimorphism in the Neanderthal pelvis; both males and females had large pelvic bones relative to their body size, with larger males having the largest pelvises. The Neanderthal chest was deep and wide, with a proportionally expansive thoracic cavity, and possibly stronger lung performance. and much higher caloric demands. The limbs are proportionally short. The body plan has traditionally been explained as a "hyper-arctic" adaptation (Allen's rule). Neanderthals would also have been effective sprinters: stronger lungs, and shorter limbs would have boosted efficiency.
Fossils attributable to the genus Ginkgo first appeared in the Middle Jurassic. The genus Ginkgo diversified and spread throughout Laurasia during the Jurassic and Early Cretaceous. The Ginkgophyta declined in diversity as the Cretaceous progressed, and by the Paleocene, Ginkgo adiantoides was the only Ginkgo species left in the Northern Hemisphere, while a markedly different (and poorly documented) form persisted in the Southern Hemisphere. Along with that of ferns, cycads, and cycadeoids, the species diversity in the genus Ginkgo drops through the Cretaceous, at the same time the flowering plants were on the rise; this supports the hypothesis that, over time, flowering plants with better adaptations to disturbance displaced Ginkgo and its associates. At the end of the Pliocene, Ginkgo fossils disappeared from the fossil record everywhere except in a small area of central China, where the modern species survived.
Sources: en.wikipedia.org
Dihexa is a synthetic peptide investigated in preclinical research. It is often classified as an angiotensin IV analog or an HGF mimetic. It is not an approved medicine.
No. Regulatory agencies have not approved dihexa for human use. It is sold as a research chemical in some markets, and human safety and efficacy data are lacking.
Laboratory studies have examined its effects on synapse formation and cognitive tasks in animals. These are early-stage findings. They do not prove benefits or safety in people.
Dihexa is a synthetic peptide analog of angiotensin IV, often described as an HGF mimetic in research literature. It is studied for effects on synaptic connectivity in laboratory models. It is not an approved medication.